Introduction

To have your samples sequenced, you must provide the sample with primer (total volume 3 microliters) in a thin walled, 200 microliter PCR tube. Please be sure to use good quality PCR tubes that form a tight seal. You can purchase a package of 50 tubes from us at $5.

To ensure quality control, sequencing controls will be run with every set of samples. You will be charged for failed sequences if the control samples sequence properly. See Sequencing TIPS to ensure success.

Initially, a maximum of 8 samples from a given lab will be sequenced per run (24h) period. Additional samples will be sequenced when space is available.

Sequencing of Plasmid DNA (PDF of Sequencing Manual)
Plasmid DNA Preparation

Introduction:

I have always used the classic "Alkaline Lysis" miniprep method to isolate plasmid DNA.

If you prefer miniprep kits, then any commercial plasmid prep kit should be fine. ABI recommends Qiagen purification kits like the Qiagen QIAprep Spin Miniprep Kit (50) Cat.#27104 for plasmid minipreps. If you are using the Qiagen QIAprep Spin Miniprep Kit ALWAYS BOIL the isolated DNA prior to quantitation. We have noticed that Qiagen Miniprep DNA is sometimes somewhat "insoluble" and boiling the sample resolves this problem. I have also successfully used Sigma's GenElute Plasmid Purification MiniPrep Kit, Product Code PLN-10 (10) or PLN-70 (70 purifications). No matter which method you use, remember to dissolve your sample DNA in ddH2O and not TE as EDTA inhibits the ABI sequencing reaction.

Primer Selection

Most commercially designed plasmid vectors have sequencing primers flanking the MCS (multiple cloning site) . The most common primers are listed below. Note that primers vary slightly by manufacturer.

T7 (17-mer) (Stratagene) 5' AATACGACTCACTATAG 3'

T7 (22-mer) (Sratagene)5' GTAATACGACTCACTATAGGGC 3'

T3 (17-mer) (Stratagene) 5' ATTAACCCTCACTAAAG 3'

T3 (20-mer) (Stratagene) 5' AATTAACCCTCACTAAAGGG 3'

SP6 (Gibco-BRL) 5' ATTTAGGTGACACTATAG 3'

M13 forward (Stratagene) 5' GTAAAACGACGGCCAG 3'

M13 forward (Gibco-BRL) 5' CCCAGTCACGACGTTGTAAAACG 3'

M13 reverse (Stratagene) 5' GGAAACAGCTATGACCATG 3'

M13 reverse (Gibco-BRL) 5' AGCGGATAACAATTTCACACAGG 3'

M13 (-20) (Stratagene) 5' GTAAAACGACGGCCAGT 3'

If you need to prepare your own sequencing primer then YOU WILL NEED TO CONFIRM that your primer is suitable ie that it does not form primer-dimer pairs, that it does not self compliment, that it?s Tm is not too low etc. This is best done using a primer analysis program. For more info see http://www.biocenter.helsinki.fi/bi/bare-1_html/oligos.htm and try their FASTPCR demo program. In general these are the preferred characteristics of your primer:

18-30 nt in length

40-60% GC content

Tm between 50oC-70oC

No primer-dimer pair formation particularly at the 3? end of the primer

Confirm that the primer is unique within your sequence

Remember that even though your primer meets all the above criteria THERE ARE NO GUARANTEES it will work. The ultimate test is the sequencing.

If your sequencing primer is NOT ideal then you can try to increase the primer concentration in the sequencing reaction from 5 pmol to 10 pmol. You may also request a modified annealing temperature, Ta.

Sequencing Sample Preparation

TIPS:

If your plasmid preparation includes a phenol/chloroform extraction be careful to remove all traces of phenol and chloroform as these will inhibit the sequencing reaction.

Amount of plasmid DNA to use depends on the size of the plasmid. The larger the plasmid being sequenced the smaller the moles of plasmid present. Therefore use the following as a guideline:
plasmid size 2-3Kb use 150 ng
plasmid size 3-5Kb use 200 ng
plasmid size 5-8Kb use 300 ng
plasmid size > 8Kb use 400 ng

Pay attention to your pipetter. Monitor the pipetting to confirm that the amounts look correct.

Sequencing data will start 20-50+ nucleotides from the 3? end of the primer site.

1. To a 200 microliter thin-walled PCR tube add the appropriate amount of sample DNA. 

2. To the sample add the sequencing primer, usually 5 pmol.

3. Bring the total volume in the tube to 3 microliters with ddH2O

4. Cap the tube and label it just below the cap with your initials and a sequential number (ie. DD1, DD2, DD3 etc). Use a waterproof marker.
   

5. Total volume of plasmid DNA and primer in the 200 microlitre thin-walled PCR tube must be 3 microlitres. The tube, on ice or frozen, and a completed SEQUENCING REQUEST FORM should be brought to the Sequencing Room ON6042 in Cell Biology (6th floor of the CancerCare Manitoba Bldg., 675 McDermot Ave.). Place the request form in the holder at the door and the tube in the RED rack located in the freezer.

Sequencing of PCR Product DNA
PCR Product Analysis

Sequencing from PCR products is usually more problematic than sequencing from a plasmid. None-the-less by using a clean PCR product and a good primer excellent sequence will be obtained. The most important aspect of PCR product sequencing is to ensure that the PCR product is a pure, single band of sufficient quantity. This can be done by running part of the product on an 1-3% agarose gel, staining with ethidium bromide (EtBr) to view the PCR DNA (Fig 1). This gel should be loaded carefully as it will later be used to predict the relative amount of purified product that will be used for sequencing. You should avoid sequencing product where:

-Multiple PCR product are observed (eg lanes labelled * in Fig 1)
-Significant artifactual smears are observed (eg lanes labelled # in Fig 1)
-Where the PCR product band is diffuse (eg lanes labelled @ in Fig 1)
-Where the PCR product band is very faint (eg lanes labelled & in Fig 1)
-One band - two products? (eg lanes labelled + in Fig 1)

Cleaning Up PCR Products

Gel Elution:

The "classic" method of purifying PCR products is to do GEL ELUTION. The band of interest is excised, PCR DNA separated from the agarose, ethidum bromide removed and purified PCR DNA reprecipitated. Commercial kits like Qbiogene's Clean-Gene II (Cat. # 1001-400) are available for this purpose. Note that there is a size limit.

Alternatively, the PCR DNA band can be eluted into a well containing 5x TBE that has been cut out in front of the PCR DNA band. Ethidium bromide is then extracted from the PCR DNA using isoamyl alcohol and purified PCR DNA is then re-precipitated.

In both cases the procedure is relatively long and the amount of PCR DNA must be relatively large; however, if a PCR fragment MUST be sequenced and multiple bands are present then this may be the only way. Where multiple bands are NOT a problem then a quicker more efficient method of purifying the PCR DNA for sequencing is the ExoSAP-IT kit.

ExoSAP-IT Kit (US78200) for rapid efficient clean-up of PCR DNA:

from Amersham Pharmacia Biotech [Available from the MICB BioBar]

ExoSAP-IT Procedure:

To 5 ul of your PCR product add 1 ul ExonucleaseI and 1 ul Shrimp Alkaline Phosphatase. Incubate at 37oC for 15 min and then 80oC for 15 min. You would then use 0.5-2 ul of this ExoSAP purified PCR product for sequencing. The amount is dependent on the intensity of the PCR product band on the ethidium bromide stained gel (5ul of a 50ul rxn). (See circled samples in Fig 1. Numbers below indicate microlitres (ul) ExoSAP purified PCR product to be used for sequencing)

Sequencing Primer Selection

Q- Can I sequence using the same primers used to generate the PCR product?

A- Ideally you would want to use a nested primer distinct from the PCR primer; however, in many cases using the same primer will give good sequence. The primer (particularly it's 3' end) must be able to bind the PCR product DNA strongly to initial elongation. If the end of the PCR product DNA obscured by tertiary folding and if the primer can not bind well to the template under sequencing conditions, then no sequence will be obtained. REMEMBER that elongation parameters in sequencing could be significantly different from those of the PCR. Ultimately the quality of the DNA, the quality of the primer and the sequencing elongation parameters will determine whether satifactory sequence will be obtained.

If you need to prepare your own sequencing primer then YOU WILL NEED TO CONFIRM that your primer is suitable ie that it does not form primer-dimer pairs, that it does not self compliment, that it?s Tm is not too low etc. This is best done using a primer analysis program. For more info see http://www.biocenter.helsinki.fi/bi/bare-1_html/oligos.htm and try their FASTPCR demo program. In general these are the preferred characteristics of your primer:

18-30 nt in length

40-60% GC content

Tm between 50oC-70oC

No primer-dimer pair formation particularly at the 3' end of the primer

Confirm that the primer is unique within your sequence

Remember that even though your primer meets all the above criteria THERE ARE NO GUARANTEES it will work. The ultimate test is the sequencing.

If your sequencing primer is NOT ideal then you can try to increase the primer concentration in the sequencing reaction from 5 pmol to 10 pmol. You may also request a modified annealing temperature, Ta.

 

Sequencing Reaction Setup

TIPS:

Purify your PCR DNA (see Cleaning up PCR products)

Amounts of purified PCR DNA to use depend on the size. The larger the PCR product being sequenced the smaller the moles present. Therefore use the following as a guideline:

PCR product size 100-200bp use 1-3 ng
PCR product size 200-500bp use 3-10 ng
PCR product size 500-1000bp use 5-20 ng
PCR product size 1000-2000bp use 10-40 ng
PCR product size >2000bp use 20-50 ng
ExoSAP-IT cleaned PCR product use 0.5-2ul (See Fig.1 & ExoSAP-IT on page 1of 3)

Pay attention to your pipetter. Monitor the pipetting to confirm that the amounts look correct.
Sequencing data will start 20-50+ nucleotides from the 3? end of the primer site.

1. To a 200 microliter thin- walled PCR tube add the appropriate amount of purified PCR DNA. 

2. To the sample add the sequencing primer, usually 5 pmol.

3. Bring the total volume in the tube to 3 microliters with ddH2O

4. Cap the tube and label it just below the cap with your initials and a sequential number (ie. DD1, DD2, DD3 etc). Use a waterproof marker.
   

5. Total volume of PCR DNA and primer in the 200 microlitre thin-walled PCR tube must be 3 microlitres. The tube, on ice or frozen, and a completed SEQUENCING REQUEST FORM should be brought to the Sequencing Room ON6042 in Cell Biology (6th floor of the CancerCare Manitoba Bldg., 675 McDermot Ave.). Place the request form in the holder at the door and the tube in the RED rack located in the freezer.